Review



n a prsi9 u6  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 93
      Buy from Supplier

    Structured Review

    Addgene inc n a prsi9 u6
    N A Prsi9 U6, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 31 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/n+a+prsi9+u6/pRSI9-U6-(sh)-UbiC-TagRFP-2A-Puro+(Plasmid+%2328289)/pm37938973-249-77-86
    Average 93 stars, based on 31 article reviews
    n a prsi9 u6 - by Bioz Stars, 2026-09
    93/100 stars

    Images

    Related Articles

    shRNA:

    Article Title: The expression profile and tumorigenic mechanisms of CD97 (ADGRE5) in glioblastoma render it a targetable vulnerability.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Glucose Thermo Fisher A2494001 Sodium pyruvate Gibco 11360070 Fetal bovine serum (FBS) Peak Serum PS-FB2 Neurobasal Medium Gibco 21103049 EGF R&D 236-EG-01M bFGF R&D 233-FB-01M GlutaMAX Supplement Gibco 35050061 MEM Non-Essential Amino Acids Gibco 11140050 N2 Supplement Gibco 17-502-049 B27-Supplement Gibco 12587010 Poly-L-Ornithine solution Sigma P4957-50mL Laminin Thermo Fisher 23017015 Lipofectamine 2000 Invitrogen 11668–019 Trypsin Thermo Fisher 25300054 Accutase Innovative Cell Technologies AT104 Lenti-X Concentrator Takara 631231 Thy1/CD90 Protein, Human, Recombinant SinoBiological 16897-HCCH Recombinant Human CD55/DAF Protein R&D 2009-CD D-glucose13C6 Sigma-Aldrich 389374 Neurobasal-A medium, no D-glucose, no sodium pyruvate Thermo Fisher A2477501 Glycine/Hydrazine 0.6M solution Sigma-Aldrich G5418 240mM NAD+ Sigma-Aldrich N0632 Lactate dehydrogenase (5U/uL) Roche 10127230001 Lactate Thermo Fisher AC18987-050 G418-sulfate Corning 61-234-RG Methanol Thermo Fisher 615130025 Metabolomics amino acid mix standard Cambridge Isotope Laboratories, Inc. MSK-A2-1.2 Disruption Beads Research Products International 9835 LC/MS Grade Water Fisher Scientific W6500 Critical commercial assays HTRF-based b-arrestin2 recruitment kit CisBio 62BDBAR2PEB Seahorse XF Cell Energy Phenotype Test Kit Agilent 103325–100 RhoA Pull-down activation assay biochem kit Cytoskeleton, Inc. BK036 Deposited Data Bulk RNA-sequencting data This paper GEO: GSE230393 Single cell multiomic data This paper GEO: GSE230389 Experimental models: Cell lines Lenti-X 293T cell Line Takara 632180 Patient-derived GBM cultures This paper N/A U-87 MG GBM cells ATCC HTB-14; RRID:CVCL_0022 Normal Human Astrocytes Lonza CC-2565 Human embryonic stem cells WA09 GRK Knockout 293T cell Lines Drube et al.53 DGRK2, DGRK6, DGRK2/6 Oligonucleotides caccGTCACAAGTCTCCGTCGGGG Eurofins Genomics CD97 gRNA1 For aaacCCCCGACGGAGACTTGTGAC Eurofins Genomics CD97 gRNA1 Rev caccGTTCATACCTGAGGATCCGA Eurofins Genomics CD97 gRNA2 For aaacTCGGATCCTCAGGTATGAAC Eurofins Genomics CD97 gRNA2 Rev (Continued on next page) Cell Reports 42, 113374, November 28, 2023 21 .. REAGENT or RESOURCE SOURCE IDENTIFIER caccgTCTGGAAGAGTGACAGCGAC Eurofins Genomics CD97 gRNA4 For aaacGTCGCTGTCACTCTTCCAGAc Eurofins Genomics CD97 gRNA4 Rev caccgGCTAGCCTCTTGTCGCCGAT Eurofins Genomics hRosa26 gRNA2 For aaacATCGGCGACAAGAGGCTAGCc Eurofins Genomics hRosa26 gRNA2 Rev accgCCGGGCGATCCTTATGGCTC ATTATCTCGAGATAATGAGCCATAA GGATCGCTTTTT Eurofins Genomics CD97 shRNA For cgaa AAAAA GCGATCCTTATGGCT CATTAT CTCGAG ATAATGAGCCAT AAGGATCGC CCGG Eurofins Genomics CD97 shRNA Rev accgccggtcctaaggttaagtcgccctcctcgag gagggcgacttaaccttaggattttt Eurofins Genomics Scrambled shRNA For cgaaaaaaatcctaaggttaagtcgccctcctcgagg agggcgacttaaccttaggaccgg Eurofins Genomics Scrambled shRNA Rev Recombinant DNA pRSI9-U6-(sh)-UbiC-TagRFP-2A-Puro Chenchik & Frangou Addgene 28289; RRID:Addgene_28289 pRSI9-U6-(CD97sh)-UbiC-TagRFP-2A-Puro Martin et al.26 N/A pRSI9-U6-(SCRsh)-UbiC-TagRFP-2A-Puro This paper N/A pCW57-RFP-P2A-MCS Barger et al.86 Addgene 78933; RRID:Addgene_78933 pBabe-neo Morgenstern et al.87 Addgene 1767; RRID:Addgene_1767 pLenti PGK Blast V5-Luc Campeau et al.88 Addgene 19166; RRID:Addgene_19166 LentiCRISPRv2-mCherry Smogorzewska Addgene 99154; RRID:Addgene_99154 pCW57-RFP-P2A-CD97 isoform 1 This paper N/A pCW57-RFP-P2A-CD97 isoform 2 This paper N/A pCW57-RFP-P2A-CD97 isoform 3 This paper N/A pCW57-RFP-P2A-CD97 S531A This paper N/A pCW57-RFP-P2A-CD97 DPS This paper N/A ..

    Recombinant:

    Article Title: The expression profile and tumorigenic mechanisms of CD97 (ADGRE5) in glioblastoma render it a targetable vulnerability.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Glucose Thermo Fisher A2494001 Sodium pyruvate Gibco 11360070 Fetal bovine serum (FBS) Peak Serum PS-FB2 Neurobasal Medium Gibco 21103049 EGF R&D 236-EG-01M bFGF R&D 233-FB-01M GlutaMAX Supplement Gibco 35050061 MEM Non-Essential Amino Acids Gibco 11140050 N2 Supplement Gibco 17-502-049 B27-Supplement Gibco 12587010 Poly-L-Ornithine solution Sigma P4957-50mL Laminin Thermo Fisher 23017015 Lipofectamine 2000 Invitrogen 11668–019 Trypsin Thermo Fisher 25300054 Accutase Innovative Cell Technologies AT104 Lenti-X Concentrator Takara 631231 Thy1/CD90 Protein, Human, Recombinant SinoBiological 16897-HCCH Recombinant Human CD55/DAF Protein R&D 2009-CD D-glucose13C6 Sigma-Aldrich 389374 Neurobasal-A medium, no D-glucose, no sodium pyruvate Thermo Fisher A2477501 Glycine/Hydrazine 0.6M solution Sigma-Aldrich G5418 240mM NAD+ Sigma-Aldrich N0632 Lactate dehydrogenase (5U/uL) Roche 10127230001 Lactate Thermo Fisher AC18987-050 G418-sulfate Corning 61-234-RG Methanol Thermo Fisher 615130025 Metabolomics amino acid mix standard Cambridge Isotope Laboratories, Inc. MSK-A2-1.2 Disruption Beads Research Products International 9835 LC/MS Grade Water Fisher Scientific W6500 Critical commercial assays HTRF-based b-arrestin2 recruitment kit CisBio 62BDBAR2PEB Seahorse XF Cell Energy Phenotype Test Kit Agilent 103325–100 RhoA Pull-down activation assay biochem kit Cytoskeleton, Inc. BK036 Deposited Data Bulk RNA-sequencting data This paper GEO: GSE230393 Single cell multiomic data This paper GEO: GSE230389 Experimental models: Cell lines Lenti-X 293T cell Line Takara 632180 Patient-derived GBM cultures This paper N/A U-87 MG GBM cells ATCC HTB-14; RRID:CVCL_0022 Normal Human Astrocytes Lonza CC-2565 Human embryonic stem cells WA09 GRK Knockout 293T cell Lines Drube et al.53 DGRK2, DGRK6, DGRK2/6 Oligonucleotides caccGTCACAAGTCTCCGTCGGGG Eurofins Genomics CD97 gRNA1 For aaacCCCCGACGGAGACTTGTGAC Eurofins Genomics CD97 gRNA1 Rev caccGTTCATACCTGAGGATCCGA Eurofins Genomics CD97 gRNA2 For aaacTCGGATCCTCAGGTATGAAC Eurofins Genomics CD97 gRNA2 Rev (Continued on next page) Cell Reports 42, 113374, November 28, 2023 21 .. REAGENT or RESOURCE SOURCE IDENTIFIER caccgTCTGGAAGAGTGACAGCGAC Eurofins Genomics CD97 gRNA4 For aaacGTCGCTGTCACTCTTCCAGAc Eurofins Genomics CD97 gRNA4 Rev caccgGCTAGCCTCTTGTCGCCGAT Eurofins Genomics hRosa26 gRNA2 For aaacATCGGCGACAAGAGGCTAGCc Eurofins Genomics hRosa26 gRNA2 Rev accgCCGGGCGATCCTTATGGCTC ATTATCTCGAGATAATGAGCCATAA GGATCGCTTTTT Eurofins Genomics CD97 shRNA For cgaa AAAAA GCGATCCTTATGGCT CATTAT CTCGAG ATAATGAGCCAT AAGGATCGC CCGG Eurofins Genomics CD97 shRNA Rev accgccggtcctaaggttaagtcgccctcctcgag gagggcgacttaaccttaggattttt Eurofins Genomics Scrambled shRNA For cgaaaaaaatcctaaggttaagtcgccctcctcgagg agggcgacttaaccttaggaccgg Eurofins Genomics Scrambled shRNA Rev Recombinant DNA pRSI9-U6-(sh)-UbiC-TagRFP-2A-Puro Chenchik & Frangou Addgene 28289; RRID:Addgene_28289 pRSI9-U6-(CD97sh)-UbiC-TagRFP-2A-Puro Martin et al.26 N/A pRSI9-U6-(SCRsh)-UbiC-TagRFP-2A-Puro This paper N/A pCW57-RFP-P2A-MCS Barger et al.86 Addgene 78933; RRID:Addgene_78933 pBabe-neo Morgenstern et al.87 Addgene 1767; RRID:Addgene_1767 pLenti PGK Blast V5-Luc Campeau et al.88 Addgene 19166; RRID:Addgene_19166 LentiCRISPRv2-mCherry Smogorzewska Addgene 99154; RRID:Addgene_99154 pCW57-RFP-P2A-CD97 isoform 1 This paper N/A pCW57-RFP-P2A-CD97 isoform 2 This paper N/A pCW57-RFP-P2A-CD97 isoform 3 This paper N/A pCW57-RFP-P2A-CD97 S531A This paper N/A pCW57-RFP-P2A-CD97 DPS This paper N/A ..



    Similar Products

    n a prsi9 u6  (Addgene inc)
    93
    Addgene inc n a prsi9 u6
    N A Prsi9 U6, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/n+a+prsi9+u6/pRSI9-U6-(sh)-UbiC-TagRFP-2A-Puro+(Plasmid+%2328289)/pm37938973-249-77-86
    Average 93 stars, based on 1 article reviews
    n a prsi9 u6 - by Bioz Stars, 2026-09
    93/100 stars
    		  Buy from Supplier

    Image Search Results